Skip to content

Latest commit

 

History

History
557 lines (419 loc) · 20.1 KB

File metadata and controls

557 lines (419 loc) · 20.1 KB

Proviral CRISPR Pipeline

A Snakemake pipeline that automates CRISPResso2 editing analysis across one or more samples. It accepts reads from paired or single-end FASTQ files, or directly from a BAM file (with optional region-level read slicing), resolves the amplicon from either an inline sequence string or a FASTA file, and optionally runs pairwise CRISPRessoCompare across labelled experiment/control groups.

Table of Contents


Overview

samples.csv
    ↓
┌──────────────────────────────────────────────┐
│  Input resolution (per sample)               │
│                                              │
│  FASTQ R1 [+ R2]  ──────────────────────┐   │
│  BAM ──→ bam2fastx ──────────────────── ┤   │
│  BAM + region ──→ cigarmath/slice ────── ┘   │
└──────────────────────────────────────────────┘
    ↓
BAM rows only: deletion_block_detection  →  deletion_detection/*  (parallel to FASTQ prep)
    ↓
CRISPResso  →  crispresso/CRISPResso_on_{sample_name}/
    ├──→  (if comparison column present)
    │     CRISPRessoCompare  →  crispresso/CRISPRessoCompare_{exp}_vs_{ctrl}/
    └──→  CRISPRessoAggregate  →  crispresso/CRISPRessoAggregate_on_all/

Key features:

  • Three flexible read input modes: paired FASTQ, single-end FASTQ, or BAM
  • BAM region slicing with cigarmath/slice — extracts only the amplicon-covering portion of long reads before passing them to CRISPResso
  • Amplicon supplied as an inline DNA string or a path to a FASTA file
  • Automatic CRISPRessoAggregate report combining all samples into one summary
  • Optional automatic pairwise comparison of every experiment sample against every control sample using CRISPRessoCompare
  • For BAM samples, cigarmath/deletion_block_detection runs on the same bam_file (read-level and block-level deletion CSVs, summary YAML, and optional per-region stats from deletion_query)
  • Wrappers fetched from GitHub by default; override with a local path for development or reproducibility pinning

Pipeline Stages

1. Read Preparation

Converts input reads into FASTQ for CRISPResso. The rule used depends on the samples.csv columns present for each sample (see Input Modes).

Rule Wrapper When used
slice_bam_region cigarmath/slice bam_file + region provided
bam_to_fastq cigarmath/bam2fastx bam_file only (no region)
(none) fastq_r1 provided directly

Intermediate files are written to fastq/ and are not final pipeline outputs.

2. Deletion block detection (rule deletion_block_detection)

For every sample with bam_file set, runs cigarmath/deletion_block_detection on that BAM (independent of slice_bam_region / bam_to_fastq).

  • Optional deletion_query column: regions in ref:start-end form; multiple regions in one cell separated by semicolons (e.g. HXB2F:500-700;HXB2F:800-900). Passed as the wrapper’s query parameter; see the wrapper README for column definitions in deletion_query_stats.csv.
  • If deletion_query is blank, deletion_query_stats.csv still appears with a header-only table.
  • Thresholds: MIN_DELETION_SIZE and DELETION_MERGE_DISTANCE in run.meta.yaml (defaults 50 and 10, same as the standalone deletion workflow).

Outputs under deletion_detection/ (see Output Files).

3. CRISPResso (rule crispresso)

Runs CRISPResso2 on each sample using the CRISPR/crispresso-core wrapper.

  • 4 threads per sample by default
  • Amplicon sequence resolved at runtime (string or FASTA — see Amplicon Resolution)
  • Guide sequence (grna column) passed as --guide_seq
  • Output: crispresso/CRISPResso_on_{sample_name}/

4. CRISPRessoAggregate (rule crispresso_aggregate)

Runs CRISPRessoAggregate across all samples in the run using the CRISPR/crispresso-aggregate wrapper. This step always executes regardless of whether the comparison column is present.

  • Input: every CRISPResso_on_{sample_name} directory produced in stage 3
  • Output: crispresso/CRISPRessoAggregate_on_all/ — a single HTML report and summary plots covering the entire run
  • 4 threads

5. CRISPRessoCompare (rule crispresso_compare)

Only generated when the comparison column is present in samples.csv. Runs CRISPRessoCompare for every combination of experiment × control sample (Cartesian product).

  • Input: the two CRISPResso_on_* directories produced in stage 3
  • Output: crispresso/CRISPRessoCompare_{exp_name}_vs_{ctrl_name}/

Quick Start

1. Prepare your run directory

mkdir my_crispr_run
cd my_crispr_run

2. Create samples.csv

FASTQ input, amplicon as a sequence string:

sample_name,grna,amplicon,fastq_r1
treated,TGCAGGTCGACAGATCCCCG,GCAGTCCGAAGGCTTAGATCCTGCAGGTCGACAGATCCCCGGGTACCGAG,reads/treated_R1.fastq.gz
control,TGCAGGTCGACAGATCCCCG,GCAGTCCGAAGGCTTAGATCCTGCAGGTCGACAGATCCCCGGGTACCGAG,reads/control_R1.fastq.gz

BAM input with region slicing and comparison labels:

sample_name,grna,amplicon,bam_file,region,comparison
treated_A,TGCAGGTCGACAGATCCCCG,amplicons/hxb2_target.fasta,bams/treated_A.bam,chr1:1000-1200,experiment
treated_B,TGCAGGTCGACAGATCCCCG,amplicons/hxb2_target.fasta,bams/treated_B.bam,chr1:1000-1200,experiment
untreated,TGCAGGTCGACAGATCCCCG,amplicons/hxb2_target.fasta,bams/untreated.bam,chr1:1000-1200,control

3. Create run.meta.yaml (optional)

If no config file is present the pipeline uses all defaults. Override settings as needed:

samples_csv: samples.csv
# damlab_prefix: /path/to/local/damlab-wrappers  # uncomment to use local wrappers

4. Run the pipeline

Locally:

cd my_crispr_run
snakemake -s /path/to/damlab-wrappers/workflows/proviral_crispr.smk \
          --use-conda --cores 8

Via data_scripts makefile:

# from the data_scripts directory
make proviral-crispr ROOT=/path/to/my_crispr_run MACHINE=Picotte

samples.csv Reference

Every row is one CRISPResso run. Either fastq_r1 or bam_file must be present.

Column Required Description
sample_name yes Unique name for this sample. Used in all output directory names.
grna yes Guide RNA sequence (without PAM). Passed to CRISPResso --guide_seq.
amplicon yes Amplicon sequence string or path to a FASTA file containing one or more amplicon sequences.
fastq_r1 cond. Path to R1 FASTQ (or the only FASTQ for single-end). Required unless bam_file is set.
fastq_r2 no Path to R2 FASTQ for paired-end experiments. Omit or leave blank for single-end.
bam_file cond. Path to a BAM file. Required unless fastq_r1 is set.
region no Genomic region in chr:start-stop format. Only used with bam_file. When set, reads are sliced to this region before CRISPResso.
comparison no experiment or control. When present, enables automatic CRISPRessoCompare runs for every experiment × control pair.
deletion_query no BAM samples only. Optional regions for per-window read/deletion counts (ref:start-end; multiple separated by ;). See Pipeline Stages §2.
guide_name no Display name for the guide RNA in CRISPResso plots (--guide_name).
amplicon_name no Display name for the amplicon (--amplicon_name). Defaults to the FASTA record ID when amplicon is a file.
quantification_window_center no Cleavage offset from the 3′ end of the guide sequence (--quantification_window_center). CRISPResso default: −3.
quantification_window_size no Number of bp around the cleavage site to include in quantification (--quantification_window_size). CRISPResso default: 1.
expected_hdr_amplicon_seq no Expected HDR (homology-directed repair) amplicon sequence (--expected_hdr_amplicon_seq).

Configuration

The pipeline reads run.meta.yaml from the working directory by default. Override with --configfile on the command line.

Key Default Description
samples_csv samples.csv Path to the samples CSV file, relative to the working directory (ROOT). Read with UTF-8 BOM support; column names are stripped so headers like deletion_query still match.
MIN_DELETION_SIZE 50 Minimum deletion length (bp) for deletion_block_detection.
DELETION_MERGE_DISTANCE 10 Merge deletion blocks whose coordinates are within this distance.
DEBUG_DELETION_QUERY true If true, the deletion wrapper writes query-param diagnostics to logs/{sample_name}.deletion_detection.log. Set to false to turn off.
damlab_prefix GitHub main branch Base URL or local path for damlab-wrappers. See below.

damlab_prefix

# Default — fetch wrappers directly from GitHub
# (no value needed in config; this is the built-in default)

# Pin to a specific release tag
damlab_prefix: https://raw.githubusercontent.com/DamLabResources/damlab-wrappers/refs/tags/v1.2.3

# Use a local checkout (development / offline use)
damlab_prefix: /home/you/repos/damlab-wrappers

When damlab_prefix starts with http:// or https://, the URL is used verbatim in the wrapper: directive. Otherwise it is prefixed with file: so Snakemake treats it as a local path.


Input Modes

Each sample is independently assigned an input mode based on which columns are populated.

FASTQ Mode

Provide fastq_r1 and optionally fastq_r2. Files are passed directly to CRISPResso without any intermediate step.

sample_name,grna,amplicon,fastq_r1,fastq_r2
my_sample,ATCGATCGATCGATCGATCG,ATCG...,reads/R1.fastq.gz,reads/R2.fastq.gz

BAM Mode (no region)

Provide bam_file without a region. All mapped reads in the BAM are exported to FASTQ using cigarmath/bam2fastx before being passed to CRISPResso. Useful when the BAM already contains only the reads of interest.

sample_name,grna,amplicon,bam_file
my_sample,ATCGATCGATCGATCGATCG,ATCG...,aligned/my_sample.bam

Intermediate file: fastq/{sample_name}.bam.fastq

BAM + Region Mode

Provide bam_file and a region in chr:start-stop format. Reads overlapping the region are sliced by cigarmath/slice — only the bases covering the target window are retained in the output FASTQ. This is the recommended mode when working with long-read data where each read may span far beyond the amplicon boundaries.

sample_name,grna,amplicon,bam_file,region
my_sample,ATCGATCGATCGATCGATCG,ATCG...,aligned/my_sample.bam,chr1:2000-2250

Intermediate file: fastq/{sample_name}.slice.fastq


Amplicon Resolution

The amplicon column accepts two forms:

Inline sequence string — any value that is not a path to an existing file is treated as the amplicon DNA sequence and passed to CRISPResso via --amplicon_seq.

amplicon
GCAGTCCGAAGGCTTAGATCCTGCAGGTCGACAGATCCCCGGGTACCGAGCTCGAATTC

FASTA file path — if the value is the path to an existing file it is used as input.amplicon_fasta. The FASTA record IDs become the amplicon names. Multiple records (comma-separated in CRISPResso) are supported.

amplicon
/path/to/reference/hxb2_target_region.fasta

The check is performed at job execution time using os.path.exists().


Pairwise Comparison

When any row has a non-empty comparison value, the pipeline automatically generates CRISPRessoCompare runs.

Rows with comparison = experiment and rows with comparison = control are identified. Every experiment sample is compared to every control sample (Cartesian product).

Example samples.csv with three samples generating two comparisons:

sample_name,grna,amplicon,fastq_r1,comparison
treated_high,TGCAGGTCGACAGATCCCCG,ATCG...,reads/high.fastq.gz,experiment
treated_low,TGCAGGTCGACAGATCCCCG,ATCG...,reads/low.fastq.gz,experiment
untreated,TGCAGGTCGACAGATCCCCG,ATCG...,reads/ctrl.fastq.gz,control

Comparisons generated:

crispresso/CRISPRessoCompare_treated_high_vs_untreated/
crispresso/CRISPRessoCompare_treated_low_vs_untreated/

If the comparison column is absent or all values are empty/NaN, no CRISPRessoCompare jobs are created.


Output Files

{ROOT}/
├── samples.csv
├── run.meta.yaml
│
├── fastq/                              # Intermediate files (BAM-derived FASTQs)
│   ├── {sample_name}.bam.fastq         #   BAM mode
│   └── {sample_name}.slice.fastq       #   BAM + region mode
│
├── deletion_detection/                 # BAM samples only (cigarmath/deletion_block_detection)
│   ├── {sample_name}.deletion_reads.csv
│   ├── {sample_name}.deletion_blocks.csv
│   ├── {sample_name}.deletion_summary.yaml
│   └── {sample_name}.deletion_query_stats.csv   # header-only if no deletion_query
│
├── crispresso/
│   ├── CRISPResso_on_{sample_name}/            # CRISPResso output (one per sample)
│   │   ├── CRISPResso_output.html
│   │   ├── Alleles_frequency_table.zip
│   │   └── ...
│   ├── CRISPRessoAggregate_on_all/             # Aggregate report across all samples
│   │   ├── CRISPRessoAggregate_output.html
│   │   └── ...
│   └── CRISPRessoCompare_{exp}_vs_{ctrl}/      # Compare output (one per pair, optional)
│       ├── CRISPRessoCompare_output.html
│       └── ...
│
└── logs/
    ├── {sample_name}.crispresso.log
    ├── {sample_name}.slice.log
    ├── {sample_name}.bam2fastx.log
    ├── {sample_name}.deletion_detection.log
    ├── aggregate.log
    └── {exp_name}_vs_{ctrl_name}.compare.log

Running on a Cluster

Using the data_scripts makefile (recommended)

On shared filesystems (e.g. NFS), Snakemake may raise MissingOutputException right after a successful SLURM job because the submit host has not yet seen files written on a compute node. The Picotte profile sets latency-wait: 90 (seconds). If you still see this, increase it (e.g. snakemake ... --latency-wait 180) or retry the same targets.

# Dry run to check the DAG
make proviral-crispr ROOT=/path/to/run MACHINE=Picotte EXTRA="-n"

# Full run on Picotte SLURM cluster
make proviral-crispr ROOT=/path/to/run MACHINE=Picotte EXTRA=""

The MACHINE=Picotte argument selects profiles/Picotte/ which is pre-configured for the Drexel Picotte cluster:

  • SLURM executor, def partition
  • crispresso jobs: 4 CPUs, 16 GB RAM, 2-hour runtime
  • All other rules: 1 CPU, 8 GB RAM, 4-hour default runtime

Directly with Snakemake

snakemake \
  -s /path/to/damlab-wrappers/workflows/proviral_crispr.smk \
  -d /path/to/run \
  --configfile /path/to/data_scripts/modes/Picotte/proviral_crispr.yaml \
  --profile /path/to/data_scripts/profiles/Picotte \
  --use-conda

Custom SLURM profile

# profiles/my_cluster/config.yaml
executor: slurm
jobs: 50
use-conda: true
conda-prefix: /shared/conda

default-resources:
  slurm_account: myproject
  slurm_partition: standard
  runtime: 120
  mem_gb: 8

set-resources:
  crispresso:
    cpus_per_task: 4
    mem_gb: 16
    runtime: 120

Usage Examples

Example 1 — Single-end FASTQ, inline amplicon

samples.csv:

sample_name,grna,amplicon,fastq_r1
ctrl,TGCAGGTCGACAGATCCCCG,GCAGTCCGAAGGCTTAGATCCTGCAGGTCGACAGATCCCCGGGTACCGAGCTCGAATTC,reads/ctrl.fastq.gz
snakemake -s workflows/proviral_crispr.smk --use-conda --cores 4

Output: crispresso/CRISPResso_on_ctrl/


Example 2 — Paired-end FASTQ, amplicon from FASTA

samples.csv:

sample_name,grna,amplicon,fastq_r1,fastq_r2
sample_A,TGCAGGTCGACAGATCCCCG,refs/amplicon.fasta,reads/A_R1.fastq.gz,reads/A_R2.fastq.gz
sample_B,TGCAGGTCGACAGATCCCCG,refs/amplicon.fasta,reads/B_R1.fastq.gz,reads/B_R2.fastq.gz

Output: crispresso/CRISPResso_on_sample_A/, crispresso/CRISPResso_on_sample_B/


Example 3 — Long-read BAM with region slicing and comparison

samples.csv:

sample_name,grna,amplicon,bam_file,region,comparison
treated_1,TGCAGGTCGACAGATCCCCG,refs/amplicon.fasta,bams/treated_1.bam,HIV1:2550-2810,experiment
treated_2,TGCAGGTCGACAGATCCCCG,refs/amplicon.fasta,bams/treated_2.bam,HIV1:2550-2810,experiment
mock,TGCAGGTCGACAGATCCCCG,refs/amplicon.fasta,bams/mock.bam,HIV1:2550-2810,control

Outputs:

crispresso/CRISPResso_on_treated_1/
crispresso/CRISPResso_on_treated_2/
crispresso/CRISPResso_on_mock/
crispresso/CRISPRessoAggregate_on_all/
crispresso/CRISPRessoCompare_treated_1_vs_mock/
crispresso/CRISPRessoCompare_treated_2_vs_mock/

Example 4 — Mixed input modes in one run

sample_name,grna,amplicon,fastq_r1,bam_file,region,comparison
illumina_treated,TGCAGGTCGACAGATCCCCG,ATCG...,reads/illumina.fastq.gz,,,experiment
nanopore_ctrl,TGCAGGTCGACAGATCCCCG,ATCG...,,bams/nano.bam,chr3:5000-5300,control

Each sample is handled independently; input mode is detected per-row.


Troubleshooting

"Sample not found in samples CSV"

The wildcard {sample_name} in an output path does not match any sample_name value in samples.csv. Check for trailing whitespace or inconsistent capitalisation in the CSV.

Deletion query_stats is header-only; log shows deletion_query param is None

Snakemake is calling the wrapper with an empty query because the value read from samples.csv for that sample_name is missing or blank. The pipeline now normalizes headers (UTF-8 BOM, spaces) and matches deletion_query case-insensitively; sample_name cells are stripped.

If it still happens, confirm the same CSV the run uses actually contains text in deletion_query for that row (cluster copy vs laptop):

python -c "import pandas as pd; df=pd.read_csv('samples.csv',encoding='utf-8-sig'); print(df.columns.tolist()); print(df[['sample_name','deletion_query']])"

CRISPResso fails with "no reads mapped to amplicon"

  • Verify the amplicon sequence matches the reference the BAM was aligned to.
  • If using region, confirm the coordinates are in chr:start-stop format and that the BAM contains reads mapping to that region:
    samtools view -c sample.bam chr1:2000-2250
  • For paired-end FASTQ, check that R1 and R2 files are in the correct order.

"Either input.amplicon_fasta or params.amplicon_seq must be provided"

The amplicon value in samples.csv was treated as a sequence string but amplicon_seq ended up empty. This can happen if the cell contains only whitespace. Check the CSV for blank or whitespace-only amplicon values.

"No such file or directory" for amplicon FASTA

The amplicon value is a path that does not exist at the time the job runs. The path is resolved relative to the Snakemake working directory (ROOT). Use an absolute path or a path relative to ROOT.

Wrapper download errors (GitHub)

By default the pipeline fetches wrappers from GitHub at each run. If the cluster has restricted outbound internet access, set damlab_prefix to a local checkout in run.meta.yaml:

damlab_prefix: /path/to/local/damlab-wrappers

Rerunning failed samples

Snakemake's standard --rerun-incomplete flag will pick up any samples whose output directory is missing or incomplete:

snakemake -s workflows/proviral_crispr.smk --use-conda --cores 8 --rerun-incomplete