diff --git a/exercises/nucleotide-count/Example.cs b/exercises/nucleotide-count/Example.cs
index 4dbd18ddc5..6fb509a90d 100644
--- a/exercises/nucleotide-count/Example.cs
+++ b/exercises/nucleotide-count/Example.cs
@@ -1,11 +1,11 @@
 using System;
 using System.Collections.Generic;
 
-public class DNA
+public class NucleotideCount
 {
     public IDictionary<char, int> NucleotideCounts { get; private set; }
 
-    public DNA(string sequence)
+    public NucleotideCount(string sequence)
     {
         InitializeNucleotideCounts(sequence);
     }
@@ -13,16 +13,15 @@ public DNA(string sequence)
     private void InitializeNucleotideCounts(string sequence)
     {
         NucleotideCounts = new Dictionary<char, int> { { 'A', 0 }, { 'T', 0 }, { 'C', 0 }, { 'G', 0 } };
-        foreach (var s in sequence)
-            NucleotideCounts[s] += 1;
-    }
-
-    public int Count(char nucleotide)
-    {
-        int count;
-        if (!NucleotideCounts.TryGetValue(nucleotide, out count))
+        try
+        {
+            foreach (var s in sequence)
+                NucleotideCounts[s] += 1;
+        }
+        catch (KeyNotFoundException)
+        {
             throw new InvalidNucleotideException();
-        return count;
+        }
     }
 }
 
diff --git a/exercises/nucleotide-count/NucleotideCount.cs b/exercises/nucleotide-count/NucleotideCount.cs
index 1c5782f612..4f71c41d2e 100644
--- a/exercises/nucleotide-count/NucleotideCount.cs
+++ b/exercises/nucleotide-count/NucleotideCount.cs
@@ -1,9 +1,9 @@
 using System;
 using System.Collections.Generic;
 
-public class DNA
+public class NucleotideCount
 {
-    public DNA(string sequence)
+    public NucleotideCount(string sequence)
     {
     }
 
@@ -14,11 +14,6 @@ public IDictionary<char, int> NucleotideCounts
             throw new NotImplementedException("You need to implement this function.");
         }
     }
-
-    public int Count(char nucleotide)
-    {
-        throw new NotImplementedException("You need to implement this function.");
-    }
 }
 
 public class InvalidNucleotideException : Exception { }
diff --git a/exercises/nucleotide-count/NucleotideCountTest.cs b/exercises/nucleotide-count/NucleotideCountTest.cs
index 71ce18f736..144c623bfd 100644
--- a/exercises/nucleotide-count/NucleotideCountTest.cs
+++ b/exercises/nucleotide-count/NucleotideCountTest.cs
@@ -1,65 +1,55 @@
-using System.Collections.Generic;
+// This file was auto-generated based on version 1.0.0 of the canonical data.
+
 using Xunit;
+using System.Collections.Generic;
 
-public class NucleoTideCountTest
+public class NucleotideCountTest
 {
     [Fact]
-    public void Has_no_nucleotides()
-    {
-        var dna = new DNA("");
-        var expected = new Dictionary<char, int> { { 'A', 0 }, { 'T', 0 }, { 'C', 0 }, { 'G', 0 } };
-        Assert.Equal(expected, dna.NucleotideCounts);
-    }
-
-    [Fact(Skip = "Remove to run test")]
-    public void Has_no_adenosine()
-    {
-        var dna = new DNA("");
-        Assert.Equal(0, dna.Count('A'));
-    }
-
-    [Fact(Skip = "Remove to run test")]
-    public void Repetitive_cytidine_gets_counts()
-    {
-        var dna = new DNA("CCCCC");
-        Assert.Equal(5, dna.Count('C'));
-    }
-
-    [Fact(Skip = "Remove to run test")]
-    public void Repetitive_sequence_has_only_guanosine()
-    {
-        var dna = new DNA("GGGGGGGG");
-        var expected = new Dictionary<char, int> { { 'A', 0 }, { 'T', 0 }, { 'C', 0 }, { 'G', 8 } };
-        Assert.Equal(expected, dna.NucleotideCounts);
-    }
-
-    [Fact(Skip = "Remove to run test")]
-    public void Counts_only_thymidine()
+    public void Empty_strand()
     {
-        var dna = new DNA("GGGGTAACCCGG");
-        Assert.Equal(1, dna.Count('T'));
+        var sut = new NucleotideCount("");
+        var expected = new Dictionary<char, int>
+        {
+            ['A'] = 0,
+            ['C'] = 0,
+            ['G'] = 0,
+            ['T'] = 0
+        };
+        Assert.Equal(expected, sut.NucleotideCounts);
     }
 
     [Fact(Skip = "Remove to run test")]
-    public void Counts_a_nucleotide_only_once()
+    public void Strand_with_repeated_nucleotide()
     {
-        var dna = new DNA("GGTTGG");
-        dna.Count('T');
-        Assert.Equal(2, dna.Count('T'));
+        var sut = new NucleotideCount("GGGGGGG");
+        var expected = new Dictionary<char, int>
+        {
+            ['A'] = 0,
+            ['C'] = 0,
+            ['G'] = 7,
+            ['T'] = 0
+        };
+        Assert.Equal(expected, sut.NucleotideCounts);
     }
 
     [Fact(Skip = "Remove to run test")]
-    public void Validates_nucleotides()
+    public void Strand_with_multiple_nucleotides()
     {
-        var dna = new DNA("GGTTGG");
-        Assert.Throws<InvalidNucleotideException>(() => dna.Count('X'));
+        var sut = new NucleotideCount("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC");
+        var expected = new Dictionary<char, int>
+        {
+            ['A'] = 20,
+            ['C'] = 12,
+            ['G'] = 17,
+            ['T'] = 21
+        };
+        Assert.Equal(expected, sut.NucleotideCounts);
     }
 
     [Fact(Skip = "Remove to run test")]
-    public void Counts_all_nucleotides()
+    public void Strand_with_invalid_nucleotides()
     {
-        var dna = new DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC");
-        var expected = new Dictionary<char, int> { { 'A', 20 }, { 'T', 21 }, { 'C', 12 }, { 'G', 17 } };
-        Assert.Equal(expected, dna.NucleotideCounts);
+        Assert.Throws<InvalidNucleotideException>(() => new NucleotideCount("AGXXACT"));
     }
-}
+}
\ No newline at end of file
diff --git a/generators/Exercises/NucleotideCount.cs b/generators/Exercises/NucleotideCount.cs
new file mode 100644
index 0000000000..a7217aac03
--- /dev/null
+++ b/generators/Exercises/NucleotideCount.cs
@@ -0,0 +1,61 @@
+using Generators.Input;
+using Generators.Output;
+using System.Collections.Generic;
+using System.Linq;
+
+namespace Generators.Exercises
+{
+    public class NucleotideCount : Exercise
+    {
+        protected override void UpdateCanonicalData(CanonicalData canonicalData)
+        {
+            foreach (var canonicalDataCase in canonicalData.Cases)
+            {
+                if (!((Dictionary<string, object>)canonicalDataCase.Expected).ContainsKey("error"))
+                {
+                    canonicalDataCase.UseVariableForExpected = true;
+                    canonicalDataCase.SetConstructorInputParameters("strand");
+                    canonicalDataCase.Expected = ConvertExpected(canonicalDataCase.Expected);
+                }
+            }
+        }
+
+        private static dynamic ConvertExpected(dynamic expected)
+            => ((Dictionary<string, object>)expected).ToDictionary(kv => kv.Key[0], kv => int.Parse($"{kv.Value}"));
+
+        protected override HashSet<string> AddAdditionalNamespaces() => new HashSet<string>() { typeof(Dictionary<char, int>).Namespace };
+
+        protected override string RenderTestMethodBodyAssert(TestMethodBody testMethodBody)
+        {
+            if (testMethodBody.UseVariableForExpected)
+            {
+                return RenderEqualBodyAssert(testMethodBody);
+            }
+            return RenderThrowsBodyAssert(testMethodBody);
+        }
+
+        private string RenderEqualBodyAssert(TestMethodBody testMethodBody)
+        {
+            const string template = @"Assert.Equal(expected, sut.{{ TestedMethodName }});";
+
+            var templateParameters = new
+            {
+                TestedMethodName = testMethodBody.CanonicalDataCase.Property.ToTestedMethodName()
+            };
+
+            return TemplateRenderer.RenderInline(template, templateParameters);
+        }
+
+        private string RenderThrowsBodyAssert(TestMethodBody testMethodBody)
+        {
+            const string template = @"Assert.Throws<InvalidNucleotideException>(() => new NucleotideCount(""{{ Input }}""));";
+
+            var templateParameters = new
+            {
+                Input = testMethodBody.CanonicalDataCase.Input["strand"]
+            };
+
+            return TemplateRenderer.RenderInline(template, templateParameters);
+        }
+    }
+}