From 879a096b95d167f1b9b1245ac2c030aabf6d79f0 Mon Sep 17 00:00:00 2001
From: Erik Schierboom <erik_schierboom@hotmail.com>
Date: Mon, 15 Jan 2018 17:58:59 +0100
Subject: [PATCH] nucleotide-count: Apply new "input" policy

---
 .../nucleotide-count/canonical-data.json      | 24 +++++++++++++------
 1 file changed, 17 insertions(+), 7 deletions(-)

diff --git a/exercises/nucleotide-count/canonical-data.json b/exercises/nucleotide-count/canonical-data.json
index 592d6dd546..597ee93ab1 100644
--- a/exercises/nucleotide-count/canonical-data.json
+++ b/exercises/nucleotide-count/canonical-data.json
@@ -1,6 +1,6 @@
 {
   "exercise": "nucleotide-count",
-  "version": "1.2.0",
+  "version": "1.3.0",
   "cases": [
     {
       "description": "count all nucleotides in a strand",
@@ -8,7 +8,9 @@
         {
           "description": "empty strand",
           "property": "nucleotideCounts",
-          "strand": "",
+          "input": {
+            "strand": ""
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -19,7 +21,9 @@
         {
           "description": "can count one nucleotide in single-character input",
           "property": "nucleotideCounts",
-          "strand": "G",
+          "input": {
+            "strand": "G"
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -30,7 +34,9 @@
         {
           "description": "strand with repeated nucleotide",
           "property": "nucleotideCounts",
-          "strand": "GGGGGGG",
+          "input": {
+            "strand": "GGGGGGG"
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -41,7 +47,9 @@
         {
           "description": "strand with multiple nucleotides",
           "property": "nucleotideCounts",
-          "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
+          "input": {
+            "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+          },
           "expected": {
             "A": 20,
             "C": 12,
@@ -52,7 +60,9 @@
         {
           "description": "strand with invalid nucleotides",
           "property": "nucleotideCounts",
-          "strand": "AGXXACT",
+          "input": {
+            "strand": "AGXXACT"
+          },
           "expected": {
             "error": "Invalid nucleotide in strand"
           }
@@ -60,4 +70,4 @@
       ]
     }
   ]
-}
+}
\ No newline at end of file