Skip to content

nucleotide-count: Apply new "input" policy #1126

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
Merged
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
24 changes: 17 additions & 7 deletions exercises/nucleotide-count/canonical-data.json
Original file line number Diff line number Diff line change
@@ -1,14 +1,16 @@
{
"exercise": "nucleotide-count",
"version": "1.2.0",
"version": "1.3.0",
"cases": [
{
"description": "count all nucleotides in a strand",
"cases": [
{
"description": "empty strand",
"property": "nucleotideCounts",
"strand": "",
"input": {
"strand": ""
},
"expected": {
"A": 0,
"C": 0,
Expand All @@ -19,7 +21,9 @@
{
"description": "can count one nucleotide in single-character input",
"property": "nucleotideCounts",
"strand": "G",
"input": {
"strand": "G"
},
"expected": {
"A": 0,
"C": 0,
Expand All @@ -30,7 +34,9 @@
{
"description": "strand with repeated nucleotide",
"property": "nucleotideCounts",
"strand": "GGGGGGG",
"input": {
"strand": "GGGGGGG"
},
"expected": {
"A": 0,
"C": 0,
Expand All @@ -41,7 +47,9 @@
{
"description": "strand with multiple nucleotides",
"property": "nucleotideCounts",
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
"input": {
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
},
"expected": {
"A": 20,
"C": 12,
Expand All @@ -52,12 +60,14 @@
{
"description": "strand with invalid nucleotides",
"property": "nucleotideCounts",
"strand": "AGXXACT",
"input": {
"strand": "AGXXACT"
},
"expected": {
"error": "Invalid nucleotide in strand"
}
}
]
}
]
}
}